-- Fasta benchmark from benchmarks game -- https://benchmarksgame-team.pages.debian.net/benchmarksgame/description/fasta.html -- -- Translated from the Java and Python versions found at -- https://benchmarksgame-team.pages.debian.net/benchmarksgame/program/fasta-java-2.html -- https://benchmarksgame-team.pages.debian.net/benchmarksgame/program/fasta-python3-1.html -- -- This differs from the Lua versions of the benchmark in some aspects -- * Don't use load/eval metaprogramming -- * Repeat fasta now works correctly when #alu < 60 -- * Use linear search (actually faster than binary search in the tests) -- * Use // integer division local IM = 139968 local IA = 3877 local IC = 29573 local seed = 42 local function random(max) seed = (seed * IA + IC) % IM return max * seed / IM; end local WIDTH = 60 local function print_fasta_header(id, desc) io.write(">" .. id .. " " .. desc .. "\n") end local function repeat_fasta(id, desc, alu, n) print_fasta_header(id, desc) local alusize = #alu local aluwrap = alu .. alu while #aluwrap < alusize + WIDTH do aluwrap = aluwrap .. alu end local lines = math.floor(n / WIDTH) local last_line = n % WIDTH local start = 0 -- (This index is 0-based bacause of the % operator) for _ = 1, lines do local stop = start + WIDTH io.write(string.sub(aluwrap, start+1, stop)) io.write("\n") start = stop % alusize end if last_line > 0 then io.write(string.sub(aluwrap, start+1, start + last_line)) io.write("\n") end end local function linear_search(ps, p) for i = 1, #ps do if ps[i]>= p then return i end end return 1 end local function random_fasta(id, desc, frequencies, n) print_fasta_header(id, desc) -- Prepare the cummulative probability table local nitems = #frequencies local letters = {} local probs = {} do local total = 0.0 for i = 1, nitems do local o = frequencies[i] local c = o[1] local p = o[2] total = total + p letters[i] = c probs[i] = total end probs[nitems] = 1.0 end -- Generate the output local col = 0 for _ = 1, n do local ix = linear_search(probs, random(1.0)) local c = letters[ix] io.write(c) col = col + 1 if col >= WIDTH then io.write("\n") col = 0 end end if col > 0 then io.write("\n") end end local HUMAN_ALU = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" .. "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" .. "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" .. "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" .. "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" .. "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" .. "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA" local IUB = { { 'a', 0.27 }, { 'c', 0.12 }, { 'g', 0.12 }, { 't', 0.27 }, { 'B', 0.02 }, { 'D', 0.02 }, { 'H', 0.02 }, { 'K', 0.02 }, { 'M', 0.02 }, { 'N', 0.02 }, { 'R', 0.02 }, { 'S', 0.02 }, { 'V', 0.02 }, { 'W', 0.02 }, { 'Y', 0.02 }, } local HOMO_SAPIENS = { { 'a', 0.3029549426680 }, { 'c', 0.1979883004921 }, { 'g', 0.1975473066391 }, { 't', 0.3015094502008 }, } return function(N) N = N or 100 repeat_fasta("ONE", "Homo sapiens alu", HUMAN_ALU, N*2) random_fasta('TWO', 'IUB ambiguity codes', IUB, N*3) random_fasta('THREE', 'Homo sapiens frequency', HOMO_SAPIENS, N*5) end